View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8958_low_18 (Length: 348)
Name: NF8958_low_18
Description: NF8958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8958_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 25 - 335
Target Start/End: Original strand, 34466405 - 34466715
Alignment:
| Q |
25 |
ctcctcctgttccgccgccactgccgccgaggttatgggagactccggtggtggtttctcaagatggtaatggtgatgttagtgttgagaatgaagaaaa |
124 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466405 |
ctcctcctgttcccccgccgctgccgccgaggttatgggagactccggtggtggtttctcaagatggtaatggtgatgttagtgttgagaatgaagaaaa |
34466504 |
T |
|
| Q |
125 |
tttgaagccaaagttgaaggctttgcattgggataaagttaaggctagctcagatagggccatggtttgggatcaactgagaccaagttcttttcagtaa |
224 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466505 |
tttaaagccaaagttgaaggctttgcattgggataaagttaaggctagctcagatagggccatggtttgggatcaactgagaccaagttcttttcagtaa |
34466604 |
T |
|
| Q |
225 |
gacacacttatgacttaactaacatcattaacatttgactttgtcttagaaacaaaaaacttgtcattatcatagtatctttgttttattctattttatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466605 |
gacacacttatgacttaactaacatcattaacatttgactttgtcttagaaacaaaaaacttgtcattatcatagtatctttgttttattctattttatg |
34466704 |
T |
|
| Q |
325 |
tgaatgttgat |
335 |
Q |
| |
|
||||||||||| |
|
|
| T |
34466705 |
tgaatgttgat |
34466715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 132 - 199
Target Start/End: Complemental strand, 10326188 - 10326121
Alignment:
| Q |
132 |
ccaaagttgaaggctttgcattgggataaagttaaggctagctcagatagggccatggtttgggatca |
199 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| | |||||| || ||| | | |||||||||||||| |
|
|
| T |
10326188 |
ccaaagttgaagcctttgcattgggataaagtgagggctagttccgatcgtgaaatggtttgggatca |
10326121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University