View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8958_low_19 (Length: 347)
Name: NF8958_low_19
Description: NF8958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8958_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 27 - 274
Target Start/End: Complemental strand, 11037489 - 11037243
Alignment:
| Q |
27 |
atgctttgtcaa-tcatactaacccaaatgtccccatcactcgagtcgtgacatagctgtggtcagaatgcagaagcttagcaagaccgaaatcagaaac |
125 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11037489 |
atgctttgtcaaatcatactaacccaaatgtccccatcactcgagtcgtgacatagctgtggtcagaatgcagaagcttagcaagaccgaaatcagaaac |
11037390 |
T |
|
| Q |
126 |
cttagagttccattgacgatcaatgagtatgttgcttgatttcacatctcggtggacgacttttggttcaagaccctcatgaagataagccaatctgaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11037389 |
cttagagttccattgacgatcaatgagtatgttgcttgatttcacatctcggtggacgacttttggttcaagaccctcatgaagataagccaatctgaaa |
11037290 |
T |
|
| Q |
226 |
agatacacaaaaatcaacgtgaacaaaacatttcaagcatcaatttgat |
274 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11037289 |
agatacacaaaaatca--ctgaacaaaacatttcaagcatcaatttgat |
11037243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 37 - 232
Target Start/End: Original strand, 29789056 - 29789251
Alignment:
| Q |
37 |
aatcatactaacccaaatgtccccatcactcgagtcgtgacatagctgtggtcagaatgcagaagcttagcaagaccgaaatcagaaaccttagagttcc |
136 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||| || | || |||| | |||||| ||||| ||||||||||| ||||| ||||||| |
|
|
| T |
29789056 |
aatcatacttacccaaatgtccccataactcgagtcgtgacataactattctcggaatttaaaagcttggcaagcccgaaatcagacaccttggagttcc |
29789155 |
T |
|
| Q |
137 |
attgacgatcaatgagtatgttgcttgatttcacatctcggtggacgacttttggttcaagaccctcatgaagataagccaatctgaaaagataca |
232 |
Q |
| |
|
|||| ||||||| ||| ||||| |||||||||||||||||||| || || |||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
29789156 |
attggcgatcaaggaggatgttacttgatttcacatctcggtgaacaacctttggttcaagaccctcatgtagataggccaatctgaaaagataca |
29789251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 194
Target Start/End: Original strand, 54530885 - 54530925
Alignment:
| Q |
154 |
atgttgcttgatttcacatctcggtggacgacttttggttc |
194 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
54530885 |
atgttgcttgattttacatctcggtggacaactttgggttc |
54530925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University