View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8958_low_20 (Length: 343)
Name: NF8958_low_20
Description: NF8958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8958_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 82 - 329
Target Start/End: Complemental strand, 47425731 - 47425483
Alignment:
| Q |
82 |
ttacactaaagtgaaagcttcttgtataacgaatccttaatcgcattagttactcacatatccaagacacttgattagtagtatggtgtccaaactcact |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425731 |
ttacactaaagtgaaagcttcttgtataacaaatccttaatcgcattagttactcacatatccaagacacttgattagtagtatggtgtccaaactcact |
47425632 |
T |
|
| Q |
182 |
tgtgtggttgttcaacgcttaatatggatggttatttgggct-cccctatgattcaacaatggtatcagatcctgatttgcaaagggttcgaccaactcc |
280 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425631 |
tgtgtggttgttcaacactcaatatggatggttatttgggctccccctatgattcaacaatggtatcagatcctgatttgcaaagggttcgaccaactcc |
47425532 |
T |
|
| Q |
281 |
ttgtatcaaaagtcttcctaactaaggttgttcaaacagcggtgcaagt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425531 |
ttgtatcaaaagtcttcctaactaaggttgttcaaacagcggtgcaagt |
47425483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University