View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8959_high_10 (Length: 429)
Name: NF8959_high_10
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8959_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 31 - 412
Target Start/End: Original strand, 38142501 - 38142885
Alignment:
| Q |
31 |
gttataatattgacattaatatgaaaataaaatggccattattatttttggaaggatatcccgttatatttttggttaaattatacttttggccccccaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38142501 |
gttataatattgacattaatatgaaaataaaatggccattattatttttggaaggatatcccgttatatttttggttaaattgtacttttggccccccaa |
38142600 |
T |
 |
| Q |
131 |
ctttcaataagcaacgattttaacccctagacattcaaaataacacttgaacccccaattta--gcatcatgtgttttattatttgcctaaatttcattg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38142601 |
ctttcaataagcaacgattttaacccctagacattcaaagtaacacttgaccccccaatttatagcatcatgtgttttattatttgcctgaatttcattg |
38142700 |
T |
 |
| Q |
229 |
ttgcccttcccct-cccaacttaaacaaacctgcgattttggcccataacaccgatgttaacctagtcgaaatcacttttgcaaaataagctaaagttgg |
327 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38142701 |
ttgcccttccccttcccaacctaaacaaacctgcgattttggcccataacaccgatgttaacctagtcgaaatcacttttgcaaaataagctaaagttgg |
38142800 |
T |
 |
| Q |
328 |
ggggccaaaaatgcaattttgaaagtttagaggtcaaaatcgctggtttgtgaaagcaggagatcaaaagtgcaagttagcctgt |
412 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38142801 |
ggggccaaaagtgcaattttgaaagtttagaggtcaaaatcgctggtttgtgaaagcaggggatcaaaagtgcaagttagcctgt |
38142885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 71
Target Start/End: Original strand, 30218962 - 30219002
Alignment:
| Q |
31 |
gttataatattgacattaatatgaaaataaaatggccatta |
71 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30218962 |
gttataattttgacatttatatgaaaataaaatggccatta |
30219002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University