View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8959_high_15 (Length: 366)
Name: NF8959_high_15
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8959_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 9e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 33489886 - 33489774
Alignment:
| Q |
16 |
ataaccatcataaaaattggtgttatggtggtcattgtctctttacttagtgttgctgcctaaagttggatggatcctcctataattttgttttgggtta |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33489886 |
ataaccatcataaaaattggtggtatggtggtcattgtctctttacttagtgttgctgcctaaagttggatggatcctcctataattttgttttgggtta |
33489787 |
T |
 |
| Q |
116 |
gagtacgccttta |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33489786 |
gagtacgccttta |
33489774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University