View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8959_high_21 (Length: 254)
Name: NF8959_high_21
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8959_high_21 |
 |  |
|
| [»] scaffold0127 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 5742382 - 5742533
Alignment:
| Q |
1 |
gccatatatttccttttctttttcttgcctagcaaagagcactttcaatgtaatttttgtctgcattannnnnnnnggaaatggtcccaagcaaaaatag |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
5742382 |
gccatatatttctttttctttttcttgcctagcaaagagcactttcaatgtaatttttgtctgcatttttttttttggaaatggtcccaagcaaaaaaag |
5742481 |
T |
 |
| Q |
101 |
-nnnnnnnttcttctcgctttcactagagggaatatgtacttctacaacaac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5742482 |
aaaaaaaattcttctcgctttcactagagggaatatgtacttctacaacaac |
5742533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 67
Target Start/End: Original strand, 5832801 - 5832845
Alignment:
| Q |
23 |
tcttgcctagcaaagagcactttcaatgtaatttttgtctgcatt |
67 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
5832801 |
tcttgcctagcaaagatcactttctatgtaatttttgtttgcatt |
5832845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0127 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0127
Description:
Target: scaffold0127; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 15048 - 15004
Alignment:
| Q |
23 |
tcttgcctagcaaagagcactttcaatgtaatttttgtctgcatt |
67 |
Q |
| |
|
|||||||||||||||| ||||||| || |||||||||| |||||| |
|
|
| T |
15048 |
tcttgcctagcaaagatcactttctatttaatttttgtttgcatt |
15004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University