View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8959_low_28 (Length: 391)
Name: NF8959_low_28
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8959_low_28 |
 | |
|
| [»] scaffold0009 (4 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 114; Significance: 1e-57; HSPs: 4)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 246 - 375
Target Start/End: Complemental strand, 41087 - 40958
Alignment:
| Q |
246 |
accatcgaatcatatagaaactaatgaaatcactgggtactcatttagtatctcaaggaaatcttacatgcaccggagattctttgacgagataaatcgt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41087 |
accatcgaatcatatagaaactaatgaaatcacagggtactcttttagtatctcaatgaaatcttacatgcaccggagattctttgacgagataaatctt |
40988 |
T |
|
| Q |
346 |
caatacatttcgtccactgcattatatctg |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40987 |
caatacatttcgtccactgcattatatctg |
40958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 377
Target Start/End: Complemental strand, 34437 - 34326
Alignment:
| Q |
268 |
aatgaaatcactgggtactcatttagtatctcaaggaaatcttacatgcaccggagattctttgac--gagataaatcgtcaatacatttcgtccactgc |
365 |
Q |
| |
|
||||||||| | ||||||| ||||| ||||||| ||||||||||||| | ||||||| ||||| |||||||||| ||||||||||||| || |||| |
|
|
| T |
34437 |
aatgaaatcgccaggtactcgtttaggatctcaatgaaatcttacatgaatgagagattcattgacaagagataaatcttcaatacatttcgacctctgc |
34338 |
T |
|
| Q |
366 |
attatatctgtg |
377 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34337 |
attatatctgtg |
34326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 66 - 134
Target Start/End: Complemental strand, 34625 - 34560
Alignment:
| Q |
66 |
ttttgttttattatattaacaatattcatctaacaaagcagttttagctgccgacgattgaatattgta |
134 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||| ||||| || |||| |||||||||||||||| |
|
|
| T |
34625 |
ttttgttttattatattaa---tattcttctaacaaagaagtttcagatgccaacgattgaatattgta |
34560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 314 - 352
Target Start/End: Complemental strand, 41125 - 41087
Alignment:
| Q |
314 |
tgcaccggagattctttgacgagataaatcgtcaataca |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41125 |
tgcaccggagattctttgacgagataaatcttcaataca |
41087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University