View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8959_low_33 (Length: 366)

Name: NF8959_low_33
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8959_low_33
NF8959_low_33
[»] chr3 (1 HSPs)
chr3 (16-128)||(33489774-33489886)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 9e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 33489886 - 33489774
Alignment:
16 ataaccatcataaaaattggtgttatggtggtcattgtctctttacttagtgttgctgcctaaagttggatggatcctcctataattttgttttgggtta 115  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33489886 ataaccatcataaaaattggtggtatggtggtcattgtctctttacttagtgttgctgcctaaagttggatggatcctcctataattttgttttgggtta 33489787  T
116 gagtacgccttta 128  Q
    |||||||||||||    
33489786 gagtacgccttta 33489774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University