View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8959_low_39 (Length: 313)

Name: NF8959_low_39
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8959_low_39
NF8959_low_39
[»] chr8 (2 HSPs)
chr8 (1-160)||(33927141-33927300)
chr8 (261-301)||(33927001-33927041)


Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 33927300 - 33927141
Alignment:
1 tattttgttccaacactttatagatccaaaatacnnnnnnncaccaatcttttatagcccaattgaattaatcttttatagccaatataattgtattcaa 100  Q
    ||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33927300 tattttgttccaacactttatagatccaaaatactttttttcaccaatcttttatagcccaattgaattaatcttttatagccaatataattgtattcaa 33927201  T
101 caatccttttgtaaccctaaatgacatccttttttcacacgatgcattacacacatagga 160  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
33927200 caatccttttgtaaccctaaatgacatctttttttcacacgatgcattacacacatagga 33927141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 261 - 301
Target Start/End: Complemental strand, 33927041 - 33927001
Alignment:
261 aatatgatacaacccaattatttttgttagtacaacaccaa 301  Q
    ||||| ||||||||||||||||||||||||| |||||||||    
33927041 aatattatacaacccaattatttttgttagtgcaacaccaa 33927001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University