View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8959_low_39 (Length: 313)
Name: NF8959_low_39
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8959_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 33927300 - 33927141
Alignment:
| Q |
1 |
tattttgttccaacactttatagatccaaaatacnnnnnnncaccaatcttttatagcccaattgaattaatcttttatagccaatataattgtattcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33927300 |
tattttgttccaacactttatagatccaaaatactttttttcaccaatcttttatagcccaattgaattaatcttttatagccaatataattgtattcaa |
33927201 |
T |
|
| Q |
101 |
caatccttttgtaaccctaaatgacatccttttttcacacgatgcattacacacatagga |
160 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33927200 |
caatccttttgtaaccctaaatgacatctttttttcacacgatgcattacacacatagga |
33927141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 261 - 301
Target Start/End: Complemental strand, 33927041 - 33927001
Alignment:
| Q |
261 |
aatatgatacaacccaattatttttgttagtacaacaccaa |
301 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33927041 |
aatattatacaacccaattatttttgttagtgcaacaccaa |
33927001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University