View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8959_low_50 (Length: 247)
Name: NF8959_low_50
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8959_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 4749534 - 4749747
Alignment:
| Q |
19 |
acctcactaatcatccacatgtcttcgaaagagccaaggttttaatactattaattaatgtggcattttcaaaatttgttactgnnnnnnnnnnnnaaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4749534 |
acctcactaatcatccacatgtcttcgaaagagccaaggttttaatactattaattaatgtggcattttcaaaatttgttactgttttttttttt-aaca |
4749632 |
T |
 |
| Q |
119 |
aacaaaactatgaaccctttcagaaagaacaagaagagattatggcaagaaggccttccgatcaaaaaggaattacacatacggaaattaggcaaatgaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4749633 |
aacaaaactatgaaccctttcagaaagaacaagaagagattatggcaagaaggccttccgatcaaaaaggacttacacatacggaaattaggcaaatgaa |
4749732 |
T |
 |
| Q |
219 |
atatctttcacaggt |
233 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
4749733 |
atatctttctcaggt |
4749747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 135 - 233
Target Start/End: Original strand, 4758195 - 4758293
Alignment:
| Q |
135 |
ctttcagaaagaacaagaagagattatggcaagaaggccttccgatcaaaaaggaattacacatacggaaattaggcaaatgaaatatctttcacaggt |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||| || |||||||||| |||||||||| | | | || |||||||| ||||||| ||||||||||| |||| |
|
|
| T |
4758195 |
ctttcagaaagaacaagaagagatcatggaaacaaggccttccactcaaaaaggactgaaccttaaggaaattaagcaaatgcaatatctttcaaaggt |
4758293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University