View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8959_low_62 (Length: 218)

Name: NF8959_low_62
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8959_low_62
NF8959_low_62
[»] chr8 (3 HSPs)
chr8 (1-88)||(43849434-43849521)
chr8 (1-55)||(43850497-43850551)
chr8 (169-214)||(43849607-43849652)


Alignment Details
Target: chr8 (Bit Score: 84; Significance: 4e-40; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 43849434 - 43849521
Alignment:
1 atatttataaaataactattggtgtcaccgttaaataaaataagtaatttaaaaacatataagaaaagctgtccaaaagggaaaacag 88  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
43849434 atatttataaaataactattggtgtcaccgttaaataaaataaataatttaaaaacatataagaaaagctgtccaaaagggaaaacag 43849521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 43850497 - 43850551
Alignment:
1 atatttataaaataactattggtgtcaccgttaaataaaataagtaatttaaaaa 55  Q
    |||||||||||||||||||| |||||||||||||||||||||| |||||| ||||    
43850497 atatttataaaataactattagtgtcaccgttaaataaaataaataattttaaaa 43850551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 43849607 - 43849652
Alignment:
169 acaaatgaaaaagtgtgtttgtgtgtctcaattgattcacacctct 214  Q
    |||||||||||||||||||||||||| |||||||||||||||||||    
43849607 acaaatgaaaaagtgtgtttgtgtgtttcaattgattcacacctct 43849652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University