View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8959_low_62 (Length: 218)
Name: NF8959_low_62
Description: NF8959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8959_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 4e-40; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 43849434 - 43849521
Alignment:
| Q |
1 |
atatttataaaataactattggtgtcaccgttaaataaaataagtaatttaaaaacatataagaaaagctgtccaaaagggaaaacag |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43849434 |
atatttataaaataactattggtgtcaccgttaaataaaataaataatttaaaaacatataagaaaagctgtccaaaagggaaaacag |
43849521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 43850497 - 43850551
Alignment:
| Q |
1 |
atatttataaaataactattggtgtcaccgttaaataaaataagtaatttaaaaa |
55 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||| |||| |
|
|
| T |
43850497 |
atatttataaaataactattagtgtcaccgttaaataaaataaataattttaaaa |
43850551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 43849607 - 43849652
Alignment:
| Q |
169 |
acaaatgaaaaagtgtgtttgtgtgtctcaattgattcacacctct |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43849607 |
acaaatgaaaaagtgtgtttgtgtgtttcaattgattcacacctct |
43849652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University