View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8960_high_5 (Length: 253)

Name: NF8960_high_5
Description: NF8960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8960_high_5
NF8960_high_5
[»] chr8 (1 HSPs)
chr8 (15-253)||(15245341-15245579)


Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 15 - 253
Target Start/End: Complemental strand, 15245579 - 15245341
Alignment:
15 tgttggtgactactctttgtgcatttacttcagcctagtatgttgctcaaacctcatttttgcgatttatcatctcccgactttcgagcataggcatggc 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||    
15245579 tgttggtgactactctttgtgcatttacttcagcctagtatgttgctcaaacctcacttttgcgatttatcatctcccaactttcgagcataggcatggc 15245480  T
115 tcactctaacacttaattattggttccaactagatgttgccatacccgcaaattcatgtgcttccataacctttagattttttactacaggaggaacttt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15245479 tcactctaacacttaattattggttccaactagatgttgccatacccgcaaattcatgtgcttccataacctttagattttttactacaggaggaacttt 15245380  T
215 gagatgataggtataaaaaatggttcttagatgacatgt 253  Q
    |||||||||||||||||||||||||||||||||||||||    
15245379 gagatgataggtataaaaaatggttcttagatgacatgt 15245341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University