View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8960_high_6 (Length: 253)
Name: NF8960_high_6
Description: NF8960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8960_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 42 - 253
Target Start/End: Original strand, 30346079 - 30346281
Alignment:
| Q |
42 |
ttagtaagcattactattagaggaaatcagcacttgtactgcaccatgtgcagataaattttctacttattagatcaacaagtcacgtcatatcacattt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30346079 |
ttagtaagcattactattagaggaaatcagcacttgtactgcaccatgcgcagataaattttctacttattagatcaacaagtcacgtcatatcacattt |
30346178 |
T |
 |
| Q |
142 |
gatctaatgatattatagtaagatttatctgcgcatggttgaaacaagctcaaacaagctcgtgtatgatgtaaatcttgtctcacttgtgtaccataaa |
241 |
Q |
| |
|
||||||||||||||||||||||| |||| || || || | | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30346179 |
gatctaatgatattatagtaagacttat-------tgattcaa--tggttgaaacaagctcgtgtatgatgtaaatcttgtctcacttgtgtaccataaa |
30346269 |
T |
 |
| Q |
242 |
attgatgttaaa |
253 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30346270 |
attgatgttaaa |
30346281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University