View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8960_low_19 (Length: 242)
Name: NF8960_low_19
Description: NF8960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8960_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 30346296 - 30346518
Alignment:
| Q |
1 |
tagagaactttggttattaatttagtcnnnnnnncttaattcagtaccataactttaaagttttaatgtttgtcttgataatcttgtcnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30346296 |
tagagaactttggttattaatttagtctttttttcttaattcagtaccataactttaaagttttaatgtttgtcttgataatcttgt---aaaaaaaaaa |
30346392 |
T |
 |
| Q |
101 |
gtttgtcttgataaacatgagactattcaaagcattatctagtactttagtgcacggaataaattgactgacactcaaattttcctttcccaattgcgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30346393 |
gtttgtcttgataaacatgagactattcaaggcattatctagtactttagtgcacggaataaattgactgacactcaaattttcctttcccaattgcgag |
30346492 |
T |
 |
| Q |
201 |
attaattcaagttctgaagtgttact |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30346493 |
attaattcaagttctgaagtgttact |
30346518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University