View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8961_high_21 (Length: 244)
Name: NF8961_high_21
Description: NF8961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8961_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 5 - 238
Target Start/End: Original strand, 12663134 - 12663367
Alignment:
| Q |
5 |
atgttgaaattataggcttctttgcaactaagatcgccggaatatagtcccaatatgttaaatattcaacggatctaaaaaattgttttttctaataaat |
104 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
12663134 |
atgttgaaattataagcttctttgcaactaagatcaccggaatatagtcccaatatattaaatattcaatggatctaaaaaattgttttttcttataaat |
12663233 |
T |
 |
| Q |
105 |
atgatcggagtaacaatattcaactccgttatagtaatggttgtctttaacgacatttcaatttttcatcttaatagcaagactttcatcacattaaagg |
204 |
Q |
| |
|
|| |||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12663234 |
ataatcgaagtaacaatgttcaactccgttatagtaatggttatctttaacgacatttcaatttttcatcttaatagcaaaactttcatcacattaaagg |
12663333 |
T |
 |
| Q |
205 |
tgttgtatacgactgaatatagtgatgtccatct |
238 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |
|
|
| T |
12663334 |
tgttgtatacaaccgaatatagtgatgtccatct |
12663367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University