View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8961_low_34 (Length: 351)
Name: NF8961_low_34
Description: NF8961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8961_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 42 - 340
Target Start/End: Original strand, 45692118 - 45692416
Alignment:
| Q |
42 |
caagtcaacaattggaatcccaacctcaatgacttttaagtttcctcttgtactgtagagtctagactgaccttgcagagatgagatcaagggaatttcg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
45692118 |
caagtcaacaattggaatcccaacctcaatgacttttaagtatcctcttgtactgtagagtctagactgaacttgcagagatgagatcaagagaatttcg |
45692217 |
T |
|
| Q |
142 |
actcatttctgaaagactgtattcttttaatttagccgcgataagtcataacctgcaagtacaactgaacgttaagttgttccaataagacgcttcttaa |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45692218 |
actcatttctgaaagactgtattcttttaatttagccgcaataagtcataacctgcaagtacaactgaacgctaagttgttccaataagacgcttcttaa |
45692317 |
T |
|
| Q |
242 |
cttcaaatcaaaaccaacatgtatttgcacacatgcatgcatgcatctactgatgcttactcatgagatttatcaatctcaatctcaatgttgcctctt |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45692318 |
cttcaaatcaaaaccaacatgtatttgcacacatgcatgcatgcatctactgatgcttactcatgagatttatcaatctcaatctcaatgttgtctctt |
45692416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University