View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8961_low_49 (Length: 279)
Name: NF8961_low_49
Description: NF8961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8961_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 268
Target Start/End: Original strand, 6741993 - 6742249
Alignment:
| Q |
16 |
gtaaccacagcatggtaggagcctgctgcaatctc--ccaccccattcacttgtgtaagttaaaaagttctttgg--agatgttgaaacaaacagaactt |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
6741993 |
gtaaccacagcatggtaggagccagctgcaatctctcccaccccattcacttgtgtaagttaaaaagttctttggttagaggttgaaacaaacagaactt |
6742092 |
T |
|
| Q |
112 |
ttacagttattttttgggatctatcaaacatgaacaaatgactctagtctttcacaatgcacataatttatctatcattaattaattgagtaattttatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6742093 |
ttacagttattttttgggatctatcaaacatgaacaaatgactctagtctttcacaatgcacataatttatctatcattaattaattgagtaattttatt |
6742192 |
T |
|
| Q |
212 |
gcatctaatattgaactattcacactatatttccttgcttcgttccaatatcttgct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6742193 |
gcatctaatattgaactattcacactatatttccttgcttcgttccaataacttgct |
6742249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University