View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8961_low_50 (Length: 274)
Name: NF8961_low_50
Description: NF8961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8961_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 47539695 - 47539437
Alignment:
| Q |
1 |
agacaagactagtgacatcgcaacaataattggtccttatttaaagttttgggattccttaatctttgagatttacatatcttgtcttgtcttgaattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47539695 |
agacaagactagtgacatcgcaacaataattggtccttatttaaagttttgggattccttaatctttgagatttacatatcttgtcttgtcttgaattga |
47539596 |
T |
 |
| Q |
101 |
aagagnnnnnnntcacagctcacgcggtttgtggggatnnnnnnngcaccaccaccaaacctgcataaacttcttttttactataggaactttattatta |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47539595 |
aagagaaaaaaatcacagctcacgcggtttgtggggataaaaaaagcaccaccaccaaacctgcataaacttcttttttactataggaactttattatta |
47539496 |
T |
 |
| Q |
201 |
tcaaattnnnnnnncatcaaccaagaaaactaaaaagcatacaaagttttgtatactct |
259 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47539495 |
tcaaattaaaaaaacatcaaccaagaaaactaaaaagcatacaaagttttgtatactct |
47539437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University