View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8963_low_50 (Length: 211)
Name: NF8963_low_50
Description: NF8963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8963_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 193
Target Start/End: Original strand, 5851824 - 5852005
Alignment:
| Q |
9 |
agaagcagagagatgtagaatggtaacatgaagtctttcatgcagtggtgattagccactcgttctatgaaaaagtatttgtcaagcaattcaactgcac |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5851824 |
agaagtagagagatgtagaatggtaacatgaagtctttcatgcagtggtgattagccactc---ctatgaaaaagtatgtgtcaagcaattcaactgcac |
5851920 |
T |
 |
| Q |
109 |
cgcacaatgtctctttcatttacctattaagtcgattggttcttgcatcattttcgaagtgagggatgccaaccatgttcttaat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5851921 |
cgcacaatgtctctttcatttacctattaagtcgattggttcttgcatcattttcgaagtgagggatgccaaccatgttcttaat |
5852005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University