View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8964_high_7 (Length: 268)

Name: NF8964_high_7
Description: NF8964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8964_high_7
NF8964_high_7
[»] chr5 (1 HSPs)
chr5 (19-256)||(8252241-8252478)
[»] chr1 (1 HSPs)
chr1 (111-256)||(44894411-44894556)
[»] chr4 (1 HSPs)
chr4 (129-167)||(20506957-20506995)
[»] chr6 (1 HSPs)
chr6 (129-173)||(19157134-19157178)


Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 8252478 - 8252241
Alignment:
19 gacctcatgttaacaaacaaaagggagctggttatctgcgtcatacagcacaaagtatgaggcatattgcaagacttccggctaaagaccgtagtgcttc 118  Q
    ||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
8252478 gacctcatgttaacaaacaaaagggagttggttatctgcgtcatacggcacaaagtatgaggcatattgcaagacttccggctaaagaccgtagtgcttc 8252379  T
119 tcagtcgtaagttaataatgagtggcagaactggttggtgcttcatggtactgattgtgtaacaacagaggacgttcgggggatagggaaggagattggg 218  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8252378 tcagtcgtcagttaataatgagtggcagaactggttggtgcttcatggtactgattgtgtaacaacagaggacgttcgggggatagggaaggagattggg 8252279  T
219 ataaaatttgcaggggataaaaataatgtgtttgatgt 256  Q
    ||||||||||||||||||||||||||| ||||||||||    
8252278 ataaaatttgcaggggataaaaataatatgtttgatgt 8252241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 111 - 256
Target Start/End: Complemental strand, 44894556 - 44894411
Alignment:
111 agtgcttctcagtcgtaagttaataatgagtggcagaactggttggtgcttcatggtactgattgtgtaacaacagaggacgttcgggggatagggaagg 210  Q
    |||| ||||||||| |  ||||||||||| ||| |||| |||||||||||||||||||||||| | ||  ||   ||||| |||  ||||||||| ||||    
44894556 agtgtttctcagtcatctgttaataatgactgggagaattggttggtgcttcatggtactgatcgagtggcacaggaggatgttacggggataggaaagg 44894457  T
211 agattgggataaaatttgcaggggataaaaataatgtgtttgatgt 256  Q
    |||||||  |||||||||  || ||||| |||||| ||||||||||    
44894456 agattggactaaaatttggcggagataataataatatgtttgatgt 44894411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 129 - 167
Target Start/End: Original strand, 20506957 - 20506995
Alignment:
129 gttaataatgagtggcagaactggttggtgcttcatggt 167  Q
    ||||||||||||||||| |||||||||||||||||||||    
20506957 gttaataatgagtggcaaaactggttggtgcttcatggt 20506995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 129 - 173
Target Start/End: Complemental strand, 19157178 - 19157134
Alignment:
129 gttaataatgagtggcagaactggttggtgcttcatggtactgat 173  Q
    ||||||||||| ||||| |||||||||||||||||||||| ||||    
19157178 gttaataatgattggcaaaactggttggtgcttcatggtattgat 19157134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University