View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8964_low_10 (Length: 375)
Name: NF8964_low_10
Description: NF8964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8964_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 51 - 358
Target Start/End: Complemental strand, 31098756 - 31098449
Alignment:
| Q |
51 |
aatatgacacattacagagtttttattatcaaaatttgttgagagacaacattcgagtgagaattttttaggagaaatgactgaaatgagcatgccaaag |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098756 |
aatatgacacattacagagtttttattatcaaaatttgttgagagacaacattcgagtgagaattttttaggagaaatgactgaaatgagcatgccaaag |
31098657 |
T |
 |
| Q |
151 |
agaggatgagcaggtggttgcgaaggcagtgggagattgtgaccaaggagggagtattttttgcatcttgatggaggtctgttgcaacaaggtaaagcca |
250 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31098656 |
agaggatgagcaggtggttgcaaaggcagtgggagattgtgaccaaggagggagtaatatttgcatcttgatggaggtctgttgcaacgaggtaaagcca |
31098557 |
T |
 |
| Q |
251 |
cgagttttaagaaaatgagagctatgtactgcgagaagagaaagatgcgtttgtttgagatggcttattattgaagaagtcacgaccatgagatggtgtt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098556 |
cgagttttaagaaaatgagagctatgtactgcgagaagagaaagatgcgtttgtttgagatggcttattattgaagaagtcacgaccatgagatggtgtt |
31098457 |
T |
 |
| Q |
351 |
gggagaag |
358 |
Q |
| |
|
|||||||| |
|
|
| T |
31098456 |
gggagaag |
31098449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University