View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8964_low_21 (Length: 268)
Name: NF8964_low_21
Description: NF8964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8964_low_21 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 101 - 268
Target Start/End: Original strand, 26969122 - 26969289
Alignment:
| Q |
101 |
tctgcagttttctgtttagcagcttccgctgtctctgcagttttctccttagcttcctctttcttgtcacccaagtaacccatagcccgtttcgccgcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26969122 |
tctgcagttttctgtttagcagcttctgctgtctctgcagttttctgtttagcttcctctttcttgtcacccaagtaacccatagcccgtttcgccgcat |
26969221 |
T |
 |
| Q |
201 |
caacagcagagtctttcatctcaccaatcttccatgctgtattatccttcccttccttcgccttctca |
268 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26969222 |
caacagcagagtccttcatctcaccaatcttccacgctgtattatccttcccttccttcgccttctca |
26969289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 9 - 146
Target Start/End: Original strand, 26968997 - 26969134
Alignment:
| Q |
9 |
acatcaaaaacatatactaccataaattcaaatttgttaccttggtcttgtcttttgcctctactgtcttttgcttagcagcctcagtggtttctgcagt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || | || |||||||| |
|
|
| T |
26968997 |
acatcaaaaacatatactaccataaattcaaatttgttaccttggtcttgtcttttgcctctactgtcttttgtttagcagcttctgctgtctctgcagt |
26969096 |
T |
 |
| Q |
109 |
tttctgtttagcagcttccgctgtctctgcagttttct |
146 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26969097 |
tttctgtttagcagcttctgctgtctctgcagttttct |
26969134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University