View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8964_low_26 (Length: 253)
Name: NF8964_low_26
Description: NF8964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8964_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 36940102 - 36939869
Alignment:
| Q |
1 |
tacctatagatcttcaatcccaagtcacttctcttagttaaggacatcttatccaagcttggcaaatgggcaggcagtcgaatagaacctcattaaagaa |
100 |
Q |
| |
|
|||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36940102 |
tacctatagagcttcagccccaagtcatttctcttagttaaggacatcttatccaagcttggcaaatgggcaggcagtcgaatagaacctcattaaagaa |
36940003 |
T |
|
| Q |
101 |
aggaaactccttattcccaggccctcccaaagtctgccttgaagaggaagtttctattcaacctatatagctatcaaataaatcacatatatattctttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| || |
|
|
| T |
36940002 |
aggaaactccttattcccaggccctcccaaagtctgccttgaagaggaagtttctattcaa--tctatagctatcaaataaatcacatatatattctctt |
36939905 |
T |
|
| Q |
201 |
gggaagaagag--acacacatgtggtaagaagggaa |
234 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36939904 |
gggaagaagagacacacacatgtggtaagaagggaa |
36939869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University