View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8964_low_29 (Length: 242)
Name: NF8964_low_29
Description: NF8964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8964_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 8420669 - 8420885
Alignment:
| Q |
20 |
tgatttacaacaaggttgtcaaagagatttctcatatattcttcatcaacatgggtagaagactgaagtgagtcatatcatatccgtagagaagcaaata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8420669 |
tgatttacaacaaggttgtcaaagagatttctcatatattcttcatcaacatgggtagaagactgaagtgagtcatatcatatccgtagagaagcaaata |
8420768 |
T |
 |
| Q |
120 |
gttgtgctaatgcattacagtctaatattgcttatagaaattgataataacaggggt-gttcgtgtccttattgttgtcatgtactctttctattgcatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8420769 |
gttgtgctaatgcattacagtctaatattgcttattgaaattgataataacatgggtggttagtgtccttattgttgtcatgtagtctttctattgcatc |
8420868 |
T |
 |
| Q |
219 |
cgtttattaacaccaaa |
235 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
8420869 |
cgtttattaacaacaaa |
8420885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University