View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8965_high_10 (Length: 232)

Name: NF8965_high_10
Description: NF8965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8965_high_10
NF8965_high_10
[»] chr7 (2 HSPs)
chr7 (107-214)||(13937008-13937115)
chr7 (14-109)||(13945371-13945466)
[»] scaffold0036 (1 HSPs)
scaffold0036 (14-108)||(103225-103319)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 107 - 214
Target Start/End: Complemental strand, 13937115 - 13937008
Alignment:
107 cgtttggatccacatagtgatcttcatcaagtgctttgtgagagttagagacatctaaagaggcggattgtgaggacaaatgactttcaactatgacatc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13937115 cgtttggatccacatagtgatcttcatcaagtgctttgtgagagttagagacatctaaagaggcggattgtgaggacaaatgactttcaactatgacatc 13937016  T
207 gtttacca 214  Q
    ||||||||    
13937015 gtttacca 13937008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 14 - 109
Target Start/End: Complemental strand, 13945466 - 13945371
Alignment:
14 acagagcagagttttcgcagtgaaacagaggagctgtagggacaggaattagttcgacattgtcttcaattgacagtttgaggtcagttgagacgt 109  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
13945466 acagagcagagttttcgcagttaaacagaggagctgtagggacaggaattagttcgacattgtcttcaattgacagtttgagatcagttgagacgt 13945371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 14 - 108
Target Start/End: Complemental strand, 103319 - 103225
Alignment:
14 acagagcagagttttcgcagtgaaacagaggagctgtagggacaggaattagttcgacattgtcttcaattgacagtttgaggtcagttgagacg 108  Q
    |||||||||| |||||||||| |||||||||||||||||| |  | |||| |||| |||||||||||||||||||  ||||| ||||||||||||    
103319 acagagcagaattttcgcagttaaacagaggagctgtaggaatggcaattggttcaacattgtcttcaattgacaacttgagatcagttgagacg 103225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University