View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8965_high_10 (Length: 232)
Name: NF8965_high_10
Description: NF8965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8965_high_10 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 107 - 214
Target Start/End: Complemental strand, 13937115 - 13937008
Alignment:
| Q |
107 |
cgtttggatccacatagtgatcttcatcaagtgctttgtgagagttagagacatctaaagaggcggattgtgaggacaaatgactttcaactatgacatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13937115 |
cgtttggatccacatagtgatcttcatcaagtgctttgtgagagttagagacatctaaagaggcggattgtgaggacaaatgactttcaactatgacatc |
13937016 |
T |
 |
| Q |
207 |
gtttacca |
214 |
Q |
| |
|
|||||||| |
|
|
| T |
13937015 |
gtttacca |
13937008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 14 - 109
Target Start/End: Complemental strand, 13945466 - 13945371
Alignment:
| Q |
14 |
acagagcagagttttcgcagtgaaacagaggagctgtagggacaggaattagttcgacattgtcttcaattgacagtttgaggtcagttgagacgt |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13945466 |
acagagcagagttttcgcagttaaacagaggagctgtagggacaggaattagttcgacattgtcttcaattgacagtttgagatcagttgagacgt |
13945371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 14 - 108
Target Start/End: Complemental strand, 103319 - 103225
Alignment:
| Q |
14 |
acagagcagagttttcgcagtgaaacagaggagctgtagggacaggaattagttcgacattgtcttcaattgacagtttgaggtcagttgagacg |
108 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||| | | |||| |||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
103319 |
acagagcagaattttcgcagttaaacagaggagctgtaggaatggcaattggttcaacattgtcttcaattgacaacttgagatcagttgagacg |
103225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University