View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8965_low_18 (Length: 311)

Name: NF8965_low_18
Description: NF8965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8965_low_18
NF8965_low_18
[»] chr4 (1 HSPs)
chr4 (1-294)||(39377920-39378213)


Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 39378213 - 39377920
Alignment:
1 ttcttcagatagtgacgtggaaatatcacnnnnnnntgttgatgttgagaatcaaaagcaaggtgagaataaagctggtacgggttcgggtacgggcact 100  Q
    |||||||||||||||||||||||||||||       |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
39378213 ttcttcagatagtgacgtggaaatatcacaaaaaaatgttgatgctgagaatcaaaagcaaggtgagaataaagctggtacgggttcgggtacaggcact 39378114  T
101 ctggtcatagttgatggtgaaagagagcttgaagtggaaacacttttgaaagcttctgcgtatattttaggagctactggttcaagtataatgtataaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39378113 ctggtcatagttgatggtgaaagagagcttgaagtggaaacacttttgaaagcttctgcgtatattttaggagctactggttcaagtataatgtataaag 39378014  T
201 ctgttcttgaagatggaacttctttagcagttcgtagaattggtgaaaatggtgttgaaaggttcaaggattttgagaatcaagttcgggttat 294  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39378013 ctgttcttgaagatggaacttctttagcagttcgtagaattggtgaaaatggtgttgaaaggttcaaggattttgagaatcaagttcgggttat 39377920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University