View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8965_low_20 (Length: 309)
Name: NF8965_low_20
Description: NF8965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8965_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 305
Target Start/End: Original strand, 2528009 - 2528310
Alignment:
| Q |
11 |
tggtgttggaagatgcatgtggatcaaaggaaattgtggatgtttcaggtattagtggcgagatatggacatgaaggaggtcacgttaaggagggaggat |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528009 |
tggtgttggaagatgcatgtggatcagaggaaattgtggacgtttcaggtattagtggcgagatatggacatgaaggaggtcacgttaaggagggaggat |
2528108 |
T |
|
| Q |
111 |
gtggtcaacttcgtggaaagagttgatgggaattggaagaggtgtggggttaggtagttggttcgacaataatatggtgcgggtggtggggcaaacaccc |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
2528109 |
gtggtcaacttggtggaaagagttgatgggaattggaagaggtgtggggttaggtagttggtttgacgataatatggtgcagatggtggggcaaacaccc |
2528208 |
T |
|
| Q |
211 |
cnnnnnnnat-------tggaaggatcagtggttaaggagccttttatttgttagatatagacgtcttttttatttgacaaagaatcgtctgcgccagtg |
303 |
Q |
| |
|
| | |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528209 |
ctttttttttttgtgtgtggaaggatcggtggttaagtagccttttatttgttagatatagacgtcttttttatttgacaaagaatcgtctgcgccagtg |
2528308 |
T |
|
| Q |
304 |
gc |
305 |
Q |
| |
|
|| |
|
|
| T |
2528309 |
gc |
2528310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 98 - 144
Target Start/End: Original strand, 35476580 - 35476626
Alignment:
| Q |
98 |
aaggagggaggatgtggtcaacttcgtggaaagagttgatgggaatt |
144 |
Q |
| |
|
|||||||||||||| |||||| || ||||||||||||| |||||||| |
|
|
| T |
35476580 |
aaggagggaggatggggtcaatttggtggaaagagttgttgggaatt |
35476626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University