View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8965_low_21 (Length: 273)
Name: NF8965_low_21
Description: NF8965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8965_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 7 - 259
Target Start/End: Complemental strand, 6386213 - 6385961
Alignment:
| Q |
7 |
tatggtgttctacttggctagaagtttttcaatcttttcatatatgtgtactgaacaagtcttctatagatacaacctcaaatcaaaatatttgaacatt |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6386213 |
tatggtattctacttggctagaagtttttcaatcttttcatatatgtgtactgaacaagtcttctatagatacaacctcaaatcaaaatatttaaacatt |
6386114 |
T |
|
| Q |
107 |
ctaacatcatgatagtatatgtaaatattttgatttagaattgtgttcatagaagacttgctcccaggaacaacacacgtcttttgtacgtgctagtttg |
206 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6386113 |
ctaacatcatgttagtatatctaaatattttgatttagaattgtgttcatagaagacttgctcccaggaacaacacatgtcttttgtacgtgctagtttg |
6386014 |
T |
|
| Q |
207 |
tggaaaaagtaaagcataaacaaacaaattaccatgttatgaacctcaaaaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6386013 |
tggaaaaagtaaagcataaacaaacaaattaccatgttatgaacctcaaaaat |
6385961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University