View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8965_low_22 (Length: 270)
Name: NF8965_low_22
Description: NF8965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8965_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 40 - 255
Target Start/End: Original strand, 15673752 - 15673968
Alignment:
| Q |
40 |
aggaatagagattgaatcttagaactctttcgttat-ctcatttaacgtctcaactcataccactgaactacatttttggatatcttttggcctatctaa |
138 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15673752 |
aggaatagagattgaaccctagaactctttcgttatactcatttaacgtctcaactcataccaatgaactacatttttggatatcttttggcctatctaa |
15673851 |
T |
 |
| Q |
139 |
tatgtttatgtggacaggggtgaacaaatatacttccaaaacaaactatagtggatttttatacttcacacacggtgctcatttattattggataaaaat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15673852 |
tatgtttatgtggacaggggtgaacaaatatacttccaaaacaaactatagtggaattttatacttcacacacggtactcatttattattggataaaaat |
15673951 |
T |
 |
| Q |
239 |
tgtaaaatatgcttcat |
255 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15673952 |
tgtaaaatatgcttcat |
15673968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University