View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8965_low_24 (Length: 264)
Name: NF8965_low_24
Description: NF8965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8965_low_24 |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0291 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 4702 - 4931
Alignment:
| Q |
19 |
agttgccaactttcacttcaacataaggatctacatttcctgtgactggatttggtggcaattctttggctttgacaacacgaacatagaggtagaacat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702 |
agttgccaactttcacttcaacataaggatctacatttcctgtgactggatttggtggcaattctttggctttgacaacacgaacatagaggtagaacat |
4801 |
T |
 |
| Q |
119 |
ctgttccacaaggtcgtaagtgctcgttgctctttcgctgtatagccaaccagttccgcctcgttgtcctccatgtggccatttttctcctagctctggc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4802 |
ctgttccacaaggtcgtaagtgctcgttgctctttcgctgtatagccaaccagttccgcctcgttgtcctccatgtggccatttttctcctagctctggc |
4901 |
T |
 |
| Q |
219 |
tttgtgtcttttagcttgtaatcatctgtg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4902 |
tttgtgtcttttagcttgtaatcatctgtg |
4931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University