View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8965_low_26 (Length: 244)
Name: NF8965_low_26
Description: NF8965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8965_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 26 - 227
Target Start/End: Complemental strand, 35054143 - 35053940
Alignment:
| Q |
26 |
tatatacgtaaatattttatcaatatttcaataattttaattacctcccctnnnnnnnnnn--tcaccgactttaaacatatcaaatcatttgctggaat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35054143 |
tatatacgtaaatattttatcaatatttcaataattttaattacctcccctaaaaaaaaaaaatcaccgactttaaacatatcaaatcatttgctggaat |
35054044 |
T |
|
| Q |
124 |
tattaaaataaccttgacaaacttcatgtggttgaaaattgaaatcacgaattgatagctagatgagacgataattgaaacacttgatgctaactgctat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35054043 |
tattaaaataaccttgacaaacttcatgtggttgaaaattgaaatcacgaattgatagttagatgagacgataattgaaacacttgatgctaactgctat |
35053944 |
T |
|
| Q |
224 |
aaat |
227 |
Q |
| |
|
|||| |
|
|
| T |
35053943 |
aaat |
35053940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 26 - 143
Target Start/End: Original strand, 34354947 - 34355067
Alignment:
| Q |
26 |
tatatacgtaaatattttatcaatatttcaataattttaattacctcccctnnnnnnnnnnt---caccgactttaaacatatcaaatcatttgctggaa |
122 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34354947 |
tatatacgtaaatattttctcaatatttcaataattttaattacctcccctaaaaaaaaattaatcaccgactttaaacatatcaaatcatttgctagaa |
34355046 |
T |
|
| Q |
123 |
ttattaaaataaccttgacaa |
143 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34355047 |
ttattaaaataaccttgacaa |
34355067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 214
Target Start/End: Original strand, 34355069 - 34355117
Alignment:
| Q |
166 |
aatcacgaattgatagctagatgagacgataattgaaacacttgatgct |
214 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
34355069 |
aatcacaaattgatagctaaatgagacgataattgaaacacttgctgct |
34355117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University