View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8965_low_27 (Length: 242)
Name: NF8965_low_27
Description: NF8965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8965_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 42026800 - 42027007
Alignment:
| Q |
1 |
aaataatcgtgtatggaattaatacatatacaactttcaaactgtaatctgcgacttcaattcctattgaaaaagaatctgcaacatcaattgtttgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42026800 |
aaataatcgtgtatggaattaatacatatacaactttcaaactgtaatctgcaacttcaatttctattgaaaaagaatctgcaacatcaattgtttgtga |
42026899 |
T |
|
| Q |
101 |
ttgttcataatgaagat-nnnnnnntggtaacctaaaaattgtgaccacagttttaaaacttggatatacatgaatccttccaatcaaaatatcttacgt |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42026900 |
ttgttcataatgaagataaaaaaaatggtaacctaaaaattgtgaccacagttttaaaacttggatatacatgaatccttccaatcaaaatatcttacgt |
42026999 |
T |
|
| Q |
200 |
tatgtaat |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
42027000 |
tatgtaat |
42027007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University