View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8966_low_41 (Length: 257)
Name: NF8966_low_41
Description: NF8966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8966_low_41 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 157 - 257
Target Start/End: Complemental strand, 49623778 - 49623678
Alignment:
| Q |
157 |
aaccgatggagaaataatcaacacaggaagattcccgctgttgatattagcgtgtttctgtttttctttggtgtcagcttgttactttcaatttcaattt |
256 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49623778 |
aaccgatggagaaataatcgacacaggaagattcccgctgttgatattagcgtgtttctgtttttctttggtgtcagtttgttactttcaatttcaattt |
49623679 |
T |
|
| Q |
257 |
c |
257 |
Q |
| |
|
| |
|
|
| T |
49623678 |
c |
49623678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 49623873 - 49623779
Alignment:
| Q |
20 |
tggtgcagtttagtgatataaataagaattgatttgcgtgtttttgttattatatggttgtttgaggaagtaagtaatatgagttaattgacgtcaag |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49623873 |
tggtgcagtttagtgatataaatacgaattgatttgcgtgtttttgttattatatggttgtttgaggaagta---aatatgagttaattgacgtcaag |
49623779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University