View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8966_low_42 (Length: 253)
Name: NF8966_low_42
Description: NF8966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8966_low_42 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 33769394 - 33769630
Alignment:
| Q |
17 |
ttctatcagaatcagcgttatgtcattgcaaatcctggcgattttgttttgtatgtgattgggaaattttgaatacaatcatagttcgaatgagaagagg |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769394 |
ttctatcagaatcagcattatgtcattgcaaatcctggcgattttgttttgtatgtgattgggaaattttgaatacaatcatagttcgaatgagaagagg |
33769493 |
T |
 |
| Q |
117 |
agaattggaaccaaatgaatctcattattcccatatatacatatatcaggaatcatgttgtaaaaccagaactatatgtgaagtaaatacatcataagtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769494 |
agaattggaaccaaatgaatctcattattcccatatatacatatatcaggaatcatgttgtaaaaccagaactatatgtgaagtaaatacatcataagtt |
33769593 |
T |
 |
| Q |
217 |
agtaatgagtacaaaaatagattctattatggttgtt |
253 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33769594 |
agtaaggagtacaaaaatagattctattatggttgtt |
33769630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University