View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8966_low_44 (Length: 252)
Name: NF8966_low_44
Description: NF8966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8966_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 51 - 207
Target Start/End: Complemental strand, 51340472 - 51340320
Alignment:
| Q |
51 |
taccacatcatcatttaagattgcatgccatcgaccatcatatttaatatttggatttgacgaaaggatgtatttgatagacgttaatcgaatactgaat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
51340472 |
taccacatcatcatttaagattgcatgccatcgaccattatatttaatatttggatttgacgaaaggatgcatttgatagacgttaatcgaatattgaat |
51340373 |
T |
 |
| Q |
151 |
gttgtgtacatacaagacctatttatttagacatccaaatgagagaactcaactgtg |
207 |
Q |
| |
|
|||| |||||||||| ||| ||||||||||||||||| ||||||||||| |||| |
|
|
| T |
51340372 |
gttgcgtacatacaaaacc----tatttagacatccaaatcagagaactcaattgtg |
51340320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University