View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8966_low_48 (Length: 241)
Name: NF8966_low_48
Description: NF8966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8966_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 27977183 - 27977389
Alignment:
| Q |
13 |
tggtggtgctgatgaaaataataaagataaagatgctgagataataagtggttatcaagttgcaaaatttcaaggtgagattcttaacatgaaacaagag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27977183 |
tggtggtgctgatgaaaataataaagataaagatgctgagataataagtggttatcaagttgcaaaatttcaaggtgagattcttaacatgaaacaagag |
27977282 |
T |
|
| Q |
113 |
aatagtaaagttgcaagtgagttacaggctggtcttagtcttgtgaaaggaatgaaaaatgatgttgagaagacacttgatgaacttgatcaagctattg |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27977283 |
aatagtaaagttgcaagtgagttacaagctggtcttagtcttgtgaaaggaatgaaaaatgatgttgagaagacacttgatgaacttgatcaagctattg |
27977382 |
T |
|
| Q |
213 |
ggattag |
219 |
Q |
| |
|
||||||| |
|
|
| T |
27977383 |
ggattag |
27977389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 172
Target Start/End: Original strand, 28306967 - 28307038
Alignment:
| Q |
98 |
aacatgaaacaagagaatagtaaagttgcaagtgagttacaggctggtcttagtcttgtgaaaggaatgaaaaat |
172 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| ||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
28306967 |
aacatgaaac--gagaatagtaa-gttgcaagtgaattacaaattagtcttattcttgtgaaaggaatgaaaaat |
28307038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University