View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8966_low_49 (Length: 221)
Name: NF8966_low_49
Description: NF8966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8966_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 14 - 91
Target Start/End: Original strand, 37778411 - 37778488
Alignment:
| Q |
14 |
cagagatcaaagaattgaacatcactttgaaattatgagccaacaaattgaactcgataccaaagctcaaacgagttt |
91 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| | ||||||||||||||||| |
|
|
| T |
37778411 |
cagagatcaaagaattgaacatcactttggaattatgagccaacaaattaaactcgatgctaaagctcaaacgagttt |
37778488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University