View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8967_low_10 (Length: 230)
Name: NF8967_low_10
Description: NF8967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8967_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 213
Target Start/End: Original strand, 30456275 - 30456477
Alignment:
| Q |
11 |
tggtgttggaatccgcgtttttgtttgcgtggctaatccggattatcgttccttggctgttttagagagctatcagttgtagggtgctcaggttgtgttt |
110 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| || ||||||||||||| ||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
30456275 |
tggtgttggaatccgcatttttgtttgcgtggctaatccagaatatcgttccttgggtgtgttagagagctgtcagctgtagggtgctcaggttgtgttt |
30456374 |
T |
|
| Q |
111 |
ggttgcggttagacaggtcggctgagggagctggtgcaggggtacagttgctgcgctgatgggttgctggttgttggtttgagtgtggtggaaaggcagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30456375 |
ggttgcggttagacaggtcggctgagggagctggtgcaggggtacagttgctgcgctgatgggttgctggttgttggtttgagtgtggtggaaaggcagt |
30456474 |
T |
|
| Q |
211 |
ttt |
213 |
Q |
| |
|
||| |
|
|
| T |
30456475 |
ttt |
30456477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University