View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8967_low_8 (Length: 249)
Name: NF8967_low_8
Description: NF8967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8967_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 34500083 - 34500326
Alignment:
| Q |
1 |
ttttcaaaaacactccttttgattcggtccaaattgcgcaatctgcagtgttgttggttaatgagtttaacttggcaaacaggaaagtggaatgtcaccg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34500083 |
ttttcaaaaacactccttttgatccggtccaaattgcgcagtctgcagtgttgttggttgatgagtttaacttggcaaacaggaaagtggaatgtcagcg |
34500182 |
T |
|
| Q |
101 |
cgtaacccctgcaccctctcggtggtgtcctcctccggatggaactatcaagattaatgtcgacgtagggtgcttcaaagatggcagcatggggtggggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34500183 |
cgtaacccctgcaccctctcggtggtgtcctcctccggatggaactatcaagattaatgtcgacgcagggtgcttcaaagatggcagcatggggtggggt |
34500282 |
T |
|
| Q |
201 |
tttgctgttagaaaccatcagggaggggtgttgttctctgctac |
244 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34500283 |
tttgctgctagaaaccatcagggaggggtgttgttctctgctac |
34500326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University