View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8967_low_9 (Length: 247)
Name: NF8967_low_9
Description: NF8967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8967_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 2258424 - 2258651
Alignment:
| Q |
1 |
tggtggttgttaatgcatgagttgatatcatggatgaggctgaagctgccatannnnnnnnnnnnnggtttgaagaaagattactatgatgagtgaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2258424 |
tggtggttgttaatgcatgagttgatatcatggatgaggctgaagctgccatattttttttttt--ggtttgaagaaagattactatgatgagtgaatta |
2258521 |
T |
 |
| Q |
101 |
tggaagagtaggtaggtatatgaaataggatcatattcatatagtatgaaaagatgtggtggaaaagaaagataa-ggtggtttgtgattatgattgtga |
199 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2258522 |
tggaagagtaggtagatatatgaaatgggatcatattcatatagtatgaaaatatgtggtggaaaagaaagataagggtggtttgtgattatgattgtga |
2258621 |
T |
 |
| Q |
200 |
accatggaataaagattttggctagtgact |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2258622 |
accatggaataaagattttggctagtgact |
2258651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University