View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8968_low_19 (Length: 404)
Name: NF8968_low_19
Description: NF8968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8968_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 333
Target Start/End: Complemental strand, 38799520 - 38799207
Alignment:
| Q |
18 |
gtatatgcctgtgagcagggtcgctggacaagtaaaatgcactgnnnnnnnncttcatgattgaacatttataaatgattcactgggcaggttcttgaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38799520 |
gtatatgcctgtgagcagggtcgctggacaagtaaaatgcact--tttttttcttcatgattgaacatttataaatgattcactgggcaggttcttgaca |
38799423 |
T |
|
| Q |
118 |
acgaaggtgaagagaccaaccgcatgaaatgcattgccgtaaatccgggaagattagccaaaggggaaggaggaggcacttttgtagaacttgattatag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38799422 |
acgaaggtgaagagaccaaccgcatgaaatgcattgccgtaaatccgggaagattagccaaaggggaaggaggaggcacttttgtagaacttgattatag |
38799323 |
T |
|
| Q |
218 |
tgggggtcccgataaaattaacgcttcaattttggccatttgaatattttgtttagaacactattattcgggcacctttgtaaaatcaatgtcttacttt |
317 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38799322 |
tgggggtctcgataaaattaacgcttcaattttggccatttgaatattttgtttagaacactatttttcgggcacctttgtaaaatcaatgtcttacttt |
38799223 |
T |
|
| Q |
318 |
ccttcaattaatgttg |
333 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38799222 |
ccttcaattaatgttg |
38799207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 343 - 389
Target Start/End: Complemental strand, 38799188 - 38799141
Alignment:
| Q |
343 |
tgtattat-acaggttttaacctgatgagatgagatgcaagtgtaaca |
389 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38799188 |
tgtattattacaggttttaacttgatgagatgagatgcaagtgtaaca |
38799141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University