View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8968_low_25 (Length: 331)
Name: NF8968_low_25
Description: NF8968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8968_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 306
Target Start/End: Complemental strand, 52003984 - 52003697
Alignment:
| Q |
19 |
agaaagtcttgacttttcactcttatataataagcaccccctttctcttaccctaagtctagtgtgaagatttgcgcagctcgagacacaactgtgttca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52003984 |
agaaagtcttgacttttcactcttatataacaagcgccccctttctcttaccctaagtctagtgtgaagatttgcgcagctcgagacacaactgtgttca |
52003885 |
T |
|
| Q |
119 |
cttctatgatccccacaaataacttggtggattacgttcgatcaattatcttatatacctatatttctctaatttttcttttcgcattgcgatcatactt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52003884 |
cttctatgatccccacaaataacttggtggattacgttggatcaattatcttatatacctatatttctctaatttttcttttcgcattacgatcatactt |
52003785 |
T |
|
| Q |
219 |
gagtcgatcaatctcataaacttttttcctctttataggtttacatgatatggagctcaattgattatatgttgcgagtgatctcacc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52003784 |
gagtcgatcaatctcataaacttttttcctcattataggtttacatgatatggagctcaattgattatatgttgcgagtgatctcacc |
52003697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 51984901 - 51984950
Alignment:
| Q |
158 |
gatcaattatcttatatacctatatttctctaatttttcttttcgcattg |
207 |
Q |
| |
|
||||||| ||||||||||| | |||| || |||||||||||||||||||| |
|
|
| T |
51984901 |
gatcaatgatcttatatacttgtattcctttaatttttcttttcgcattg |
51984950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University