View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8968_low_27 (Length: 324)
Name: NF8968_low_27
Description: NF8968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8968_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 86 - 324
Target Start/End: Original strand, 30785897 - 30786138
Alignment:
| Q |
86 |
gttcttcatccgaaggttcttttcttgccattctatctggacttaacttgttaattgattcatt----ctaaataggattttgattatgtttaatagata |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30785897 |
gttcttcatccgaaggttcttttcttgccattctatctggagttaacttgttgattgattcattaattctaaataggattttgattatgtttaatagata |
30785996 |
T |
 |
| Q |
182 |
tgtatatgctttgatgactaattataggtttgattgtgaaattactttcgttaattataatcacgtgttaaacaatttaataatgcatttcttgttataa |
281 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
30785997 |
tgtatatgctttgatgattaattataggtttgattgtgaaattacttttgttaattataatcacgt-ttaaacaatttaataatgaatttcttgttataa |
30786095 |
T |
 |
| Q |
282 |
taccatgaaacatcgctgctggaatctgtgacagaaacattgc |
324 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30786096 |
taccatgtaacatcgctgctggaatctgtgacagaaacattgc |
30786138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University