View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8968_low_33 (Length: 241)
Name: NF8968_low_33
Description: NF8968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8968_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 8436937 - 8437160
Alignment:
| Q |
1 |
atatcatgtgttgggagattggaagaggctttggtgtgttaaagtaccccttaaggttcgtaacttaaattcaagaattagtcgagggtgcttacaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8436937 |
atatcatgtgttgggagattggaagaggctttggtgtgttaaagtaccccttaaggttcgtaacttaaattcaagaattagtcgagggtgcttacaaact |
8437036 |
T |
|
| Q |
101 |
agagtgagacttcaaattcgtagaattcaatgcccc-aaatattgctatttttgtgaagatggtttggagaatgatctgcaagtgttggtttggtgcagc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437037 |
agagtgagacttcaaattcgtagaattcaatgccccaaaatattgctatttttgtgaagatggtttggagaatgatctgcaagtgttggtttggtgcagc |
8437136 |
T |
|
| Q |
200 |
tttggcaggaaggtgtggtctact |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8437137 |
tttggcaggaaggtgtggtctact |
8437160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University