View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8969_low_48 (Length: 323)
Name: NF8969_low_48
Description: NF8969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8969_low_48 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 26697040 - 26696749
Alignment:
| Q |
1 |
taatgattgg-ttggtggtgtctggtcaagaatgtgccaccgtttgttcgatccaagatgttaaatccttaacttgacagaaattgatgacgagagttta |
99 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26697040 |
taatgattgggttggtggtgtctggtcaagaatgtgccaccgtttgttcgatccaagatgttaaattcttaacttgacagaaattgatgacgagagttta |
26696941 |
T |
|
| Q |
100 |
aacttatcagaacaagaacaaaatcagcaatgcattcatcgtaccagaagtatgtgatcccaattttatgttcatatgctattgtcatgattgtatggtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26696940 |
aacttatcagaacaagaacaaaatcagcaatgcattcatcgtaccagaagtatgtgatcccaattttatgttcatatgctattgtcatgattgtatggtt |
26696841 |
T |
|
| Q |
200 |
taagtttgaacttcattggaataattttatgattccctttgcattttgttttgttcctatactaggggtgtttctagaaagcttattttgttt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26696840 |
taagtttgaacttcattggaataattttatgattccctttgcattttgttttgttcctatactaggggtgtttctag-aagcttattttgttt |
26696749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University