View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8969_low_66 (Length: 249)
Name: NF8969_low_66
Description: NF8969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8969_low_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 55823604 - 55823813
Alignment:
| Q |
18 |
tgatccttctaaggcttatcaaatggtatgtgcaactctaactctcttttttgctcaatgtatttatattctcaaatctcgatcgatcatgttttcagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55823604 |
tgatccttctaaggcttatcaaatggtatgtgcaactctaactctcttttttgctcaatgtatttatattctcaaatctcgatcgatcatgttttcagtt |
55823703 |
T |
|
| Q |
118 |
ggttgattgtttaaactggagagtacaaaatcagattgacaatatattatctgtaagtttcttattctatatcttcatcctttacattatttctttatcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55823704 |
ggttgattgtttaaactggagagtacaaaatcagattgacaatatattatctgtaagtttcttattctatatcttcatcctttacattatttctttatcg |
55823803 |
T |
|
| Q |
218 |
atcacctcta |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
55823804 |
atcacctcta |
55823813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 56153822 - 56153653
Alignment:
| Q |
18 |
tgatccttctaaggcttatcaaatggtatgtgcaactctaactctcttttttgctcaatgtatttatattctcaaatctcgatcgatcatgttttcagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
56153822 |
tgatccttctaaggcttatcaaatggtatgtgcaactctaactctctttttttctcaatgtatgtatattctcaaatctcgatc----atgttttcagtt |
56153727 |
T |
|
| Q |
118 |
ggttgattgtttaaactggagagtacaaaatcagattgacaatatattatctgtaagtttcttattctatatctt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
56153726 |
ggttgattgtttaaactggagagtacaaaatcagattgacaatatattatctgtaagtttc-tattctatttctt |
56153653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University