View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8969_low_74 (Length: 238)
Name: NF8969_low_74
Description: NF8969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8969_low_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 26766097 - 26765875
Alignment:
| Q |
1 |
gttcgatgattgcaaataatccgactctttaatagcaaaagttgaagaaaattttgaaaatcccaaaccttcaatttttt-aatacaaacttaatcttta |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
26766097 |
gttcgatgattgcaaataatccgagtctttaatagcaaaagttgaagaaaattttgaaaatctcagaccttcaatttttttaatacaaacttaatcttta |
26765998 |
T |
 |
| Q |
100 |
tgatacaattaaccaaacaactctacctttatttaatcattaagcatgacaaaagatacaacaatttaattgaaattctcaatagcagcttgaactttat |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26765997 |
tgatacaattaaccaaacaactatacctttatttaatcattaagcatgacaaaagatacaacaatttaattgaaattctcaatagcagcttgaactttat |
26765898 |
T |
 |
| Q |
200 |
gtatttcatttgatgcttcatgt |
222 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
26765897 |
gtattccatttgatgcttcatgt |
26765875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 162 - 222
Target Start/End: Complemental strand, 26786037 - 26785977
Alignment:
| Q |
162 |
aatttaattgaaattctcaatagcagcttgaactttatgtatttcatttgatgcttcatgt |
222 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||| | ||||||||||||||||| |
|
|
| T |
26786037 |
aatttaattgaaattctcaatagcaacttgaacttcatgtagtccatttgatgcttcatgt |
26785977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University