View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8969_low_76 (Length: 211)
Name: NF8969_low_76
Description: NF8969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8969_low_76 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 18 - 154
Target Start/End: Complemental strand, 33631232 - 33631097
Alignment:
| Q |
18 |
agaagacgtaggtaaaattagctacagcagttgggacatgcagtacccgttctatggatcctcttccaacaagttctcgatgaaatacctttcttggaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33631232 |
agaagacgtaggtaaaattagctacagcagttgggacatgcagtacccgttctatggatcctcttccaacaagttctc-atgaaatacctttcttggaac |
33631134 |
T |
|
| Q |
118 |
attcgggggttaggttcttcttgatgaagttatttac |
154 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33631133 |
attcgggggttaggttcttcttgatggagttatttac |
33631097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 189
Target Start/End: Complemental strand, 33631076 - 33631042
Alignment:
| Q |
155 |
gttttcacacgtttttcaataatatttgtgagcac |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33631076 |
gttttcacacgtttttcaataatatttgtgagcac |
33631042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University