View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8969_low_79 (Length: 201)
Name: NF8969_low_79
Description: NF8969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8969_low_79 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 182
Target Start/End: Complemental strand, 40112394 - 40112221
Alignment:
| Q |
9 |
agattatacttatattaatagaaattgtttaacataatactatatattcatatttcagcaaatgtcaaaatatagagggaggaattggtaaaactaaaag |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40112394 |
agattatatttatattaatagaaattgtttaacataatactatatattcatatttcagcaaatgtcaaaatatagagggaggaattggtaaaactaaaag |
40112295 |
T |
|
| Q |
109 |
caattaagatgagaagaaggtggatgagaatccaatacgttttctttattccaaaatagagagagtgatcgatc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40112294 |
caattaagatgagaagaaggtggatgagaatccaatacgttttctttattccaaaatagagagagtgatcgatc |
40112221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University