View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8970_low_15 (Length: 424)
Name: NF8970_low_15
Description: NF8970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8970_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 40558230 - 40558024
Alignment:
| Q |
22 |
ttcgtgttgtgtttccaaagttaaagaagttacgcattctctttctctttctcataaacaaatttcatcactttttctgatctaacaaactcacattcat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40558230 |
ttcgtgttgtgtttccaaagttaaagaagttacgcattctctttctctttctcataaacaaatttcatcactttttctgatctaacaaactcacattcat |
40558131 |
T |
|
| Q |
122 |
catcatcgcaatggattcccgctcagcaccaccacaacaacctactatgatggtgggacccacatcttacggtccaactaacaccaccatgatcagcccc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40558130 |
catcatcgcaatggattcccgctcagcaccaccacaacaacctactatgatggtgggacccacatcttacgctccaactaacaccaccatgatcagcccc |
40558031 |
T |
|
| Q |
222 |
aactcct |
228 |
Q |
| |
|
||||||| |
|
|
| T |
40558030 |
aactcct |
40558024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 255 - 408
Target Start/End: Complemental strand, 40558009 - 40557856
Alignment:
| Q |
255 |
gcgaacatcatggcacccgctacagctcgttttcctttcgcttctccgcaatcggagccgttttcggttactcatgacggtccttcttctccgtcgacgc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40558009 |
gcgaacatcatggcacccgctacagctcgttttcctttcgcttctccgcaatcggagccgttttcggttactcatgacggtccttcttctccgtcgacgc |
40557910 |
T |
|
| Q |
355 |
ttgggaagaagaaacgtggccggccgaggaaatactcgcctgatggtaacattg |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40557909 |
ttgggaagaagaaacgtggccggccgaggaaatactcgcctgatggtaacattg |
40557856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University